WormMine: Gene WBGene00120618

• WormBase Gene ID: WBGene00120618
• Gene Name: Cjp-nuc-1
• Sequence Name: CJA01414
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable deoxyribonuclease II activity. Predicted to be involved in DNA metabolic process. Is an ortholog of C. elegans nuc-1. In C. elegans, nuc-1 is involved in apoptotic DNA fragmentation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA01414b.1	CJA01414b.1		[unknown]
Transcript:CJA01414a.1	CJA01414a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA01414b	CJA01414b		[unknown]
CDS:CJA01414a	CJA01414a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1079963
• Remark: Cjp-nuc-1, TCAGCAGCACATTCCTCTGGAATGCTTACAGTGTTATTGCCACTCAAAATACTTGTGCTT, WBGene00120618
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region