WormMine: Gene WBGene00120722

• WormBase Gene ID: WBGene00120722
• Gene Name: CJA01518
• Sequence Name: CJA01518
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable carbohydrate derivative binding activity and glutamine-fructose-6-phosphate transaminase (isomerizing) activity. Predicted to be involved in carbohydrate derivative biosynthetic process. Is an ortholog of C. elegans gfat-1 and gfat-2. In C. elegans, gfat-1 is involved in IRE1-mediated unfolded protein response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA01518a.1	CJA01518a.1		[unknown]
Transcript:CJA01518b.1	CJA01518b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA01518a	CJA01518a		[unknown]
CDS:CJA01518b	CJA01518b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1084690
• Remark: CJA01518, GGAATGAAGCACGTTCTTCGTGTGCCAAAGACCGTCGACTGTGTGCAGAATATTCTCACC, WBGene00120722
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region