WormMine: Gene WBGene00120777

• WormBase Gene ID: WBGene00120777
• Gene Name: Cjp-daf-22
• Sequence Name: CJA01573
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable acyltransferase activity, transferring groups other than amino-acyl groups. Is an ortholog of C. elegans daf-22. In C. elegans, daf-22 is involved in several processes, including ascaroside biosynthetic process; dauer larval development; and positive regulation of developmental process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA01573.1	CJA01573.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA01573	CJA01573		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1083236
• Remark: CJA01573, AAGAGACAGGTGCCAAACTGCAAACTTGCCATGCAGCACAATGTGGGAATTGGAGGAGCC, WBGene00120777
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region