WormMine: Gene WBGene00120885

• WormBase Gene ID: WBGene00120885
• Gene Name: CJA01681
• Sequence Name: CJA01681
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable guanylate cyclase activity and heme binding activity. Predicted to be involved in cGMP biosynthetic process. Is an ortholog of C. elegans gcy-35. In C. elegans, gcy-35 is involved in aerotaxis; cGMP-mediated signaling; and response to stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA01681a.1	CJA01681a.1		[unknown]
Transcript:CJA01681c.1	CJA01681c.1		[unknown]
Transcript:CJA01681b.1	CJA01681b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA01681a	CJA01681a		[unknown]
CDS:CJA01681b	CJA01681b		[unknown]
CDS:CJA01681c	CJA01681c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1072113
• Remark: Cjp-gcy-35, GATTTGCTCGAATTGGTTCATCCAGAAGTTCCATTTTCATACGAGTCTATTCGATATTAT, WBGene00120885
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region