WormMine: Gene WBGene00120951

• WormBase Gene ID: WBGene00120951
• Gene Name: Cjp-egl-10
• Sequence Name: CJA01747
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be involved in G protein-coupled receptor signaling pathway; intracellular signal transduction; and regulation of G protein-coupled receptor signaling pathway. Is an ortholog of C. elegans egl-10. In C. elegans, egl-10 is involved in several processes, including G protein-coupled dopamine receptor signaling pathway; regulation of egg-laying behavior; and rhythmic behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA01747.1	CJA01747.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA01747	CJA01747		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1077753
• Remark: Cjp-egl-10, ATTTACAACGAGTTTATCGATACGAATGCGGCAACGTCGCCGGTCAATGTGGATTGTAAA, WBGene00120951
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region