WormMine: Gene WBGene00121110

• WormBase Gene ID: WBGene00121110
• Gene Name: Cjp-dkf-2
• Sequence Name: CJA01906
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ATP binding activity and protein serine/threonine kinase activity. Is an ortholog of C. elegans dkf-2. In C. elegans, dkf-2 is involved in defense response to bacterium; determination of adult lifespan; and signal transduction.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA01906b.1	CJA01906b.1		[unknown]
Transcript:CJA01906a.1	CJA01906a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA01906b	CJA01906b		[unknown]
CDS:CJA01906a	CJA01906a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081047
• Remark: Cjp-dkf-2, TTGTCACCCACGAATCGGACGATGTCAGATGGCATGCGTACGAGATTGAGAATAATGTAA, WBGene00121110
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region