WormMine: Gene WBGene00121209

• WormBase Gene ID: WBGene00121209
• Gene Name: Cjp-mans-2
• Sequence Name: CJA02005
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable calcium ion binding activity and mannosyl-oligosaccharide 1,2-alpha-mannosidase activity. Predicted to be involved in carbohydrate metabolic process. Predicted to be located in membrane. Is an ortholog of C. elegans mans-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA02005a.1	CJA02005a.1		[unknown]
Transcript:CJA02005c.1	CJA02005c.1		[unknown]
Transcript:CJA02005b.1	CJA02005b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA02005a	CJA02005a		[unknown]
CDS:CJA02005b	CJA02005b		[unknown]
CDS:CJA02005c	CJA02005c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081681
• Remark: CJA02005, GGAAAAACCATGTACAGAGATTGGGTTTGGGATGCTGTACAGGCGGTCGACAAATATTGT, WBGene00121209
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region