WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00121430 Gene Name  CJA02226
Sequence Name  ? CJA02226 Organism  Caenorhabditis japonica
Automated Description  Predicted to enable acyltransferase activity. Is an ortholog of C. elegans Y38C1AA.1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA02226a.1 CJA02226a.1   [unknown]
Transcript:CJA02226b.1 CJA02226b.1   [unknown]
Transcript:CJA02226c.1 CJA02226c.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA02226a CJA02226a   [unknown]
CDS:CJA02226c CJA02226c   [unknown]
CDS:CJA02226b CJA02226b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA02226, GAAAACAGTGAAACGAGAGATCCGTTCGATGATTAAGGAACACCAACGCCTTCCGGGAAG, WBGene00121430   Expr1080102 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region