WormMine: Gene WBGene00121595

• WormBase Gene ID: WBGene00121595
• Gene Name: Cjp-pal-1
• Sequence Name: CJA02391
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable DNA binding activity. Is an ortholog of C. elegans pal-1. In C. elegans, pal-1 is involved in several processes, including cell fate commitment; embryonic pattern specification; and positive regulation of DNA-templated transcription.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA02391.1	CJA02391.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA02391	CJA02391		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081398
• Remark: Cjp-pal-1, AGCTCGAAAAAGAATTCCACACGTCACCGTTCGTGAACGCCGACCGCAAAACCCAACTGT, WBGene00121595
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region