WormMine: Gene WBGene00122022

• WormBase Gene ID: WBGene00122022
• Gene Name: Cjp-dpy-22
• Sequence Name: CJA02818
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable transcription coregulator activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to be part of mediator complex. Is an ortholog of C. elegans dpy-22. In C. elegans, dpy-22 is involved in negative regulation of epidermal growth factor receptor signaling pathway and negative regulation of vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA02818.1	CJA02818.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA02818	CJA02818		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1074622
• Remark: Cjp-dpy-22, CAACAACAACCAGGCCAGCAGCAACCGCAACATGGCTACGGAATGGGTCAGTATCCCAAC, WBGene00122022
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region