WormMine: Gene WBGene00122094

• WormBase Gene ID: WBGene00122094
• Gene Name: CJA02890
• Sequence Name: CJA02890
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable metalloendopeptidase activity and zinc ion binding activity. Predicted to be involved in proteolysis. Predicted to be located in extracellular matrix. Is an ortholog of C. elegans zmp-5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA02890.1	CJA02890.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA02890	CJA02890		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081816
• Remark: CJA02890, AAGCACTCTTCAAACTACTTGTCTATTATGGCTCCGTTTTACAAACAGTACACCGGTGAT, WBGene00122094
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region