WormMine: Gene WBGene00122128

• WormBase Gene ID: WBGene00122128
• Gene Name: CJA02924
• Sequence Name: CJA02924
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable RNA binding activity. Is an ortholog of C. elegans Y57G11C.36.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA02924a.2	CJA02924a.2		[unknown]
Transcript:CJA02924a.1	CJA02924a.1		[unknown]
Transcript:CJA02924c.1	CJA02924c.1		[unknown]
Transcript:CJA02924b.1	CJA02924b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA02924c	CJA02924c		[unknown]
CDS:CJA02924a	CJA02924a		[unknown]
CDS:CJA02924b	CJA02924b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1073472
• Remark: CJA02924, GGCGAGCCGCGACGCTATGACGACATGGTCAAGGCGCAGGAGATTGGAAAACGCATGTGC, WBGene00122128
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region