WormMine: Gene WBGene00122135

• WormBase Gene ID: WBGene00122135
• Gene Name: Cjp-sqv-6
• Sequence Name: CJA02931
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable protein xylosyltransferase activity. Predicted to be involved in proteoglycan biosynthetic process. Predicted to be located in membrane. Is an ortholog of C. elegans sqv-6. In C. elegans, sqv-6 is involved in several processes, including UDP-D-xylose metabolic process; egg-laying behavior; and glycosaminoglycan biosynthetic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA02931a.1	CJA02931a.1		[unknown]
Transcript:CJA02931b.1	CJA02931b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA02931a	CJA02931a		[unknown]
CDS:CJA02931b	CJA02931b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081498
• Remark: Cjp-sqv-6, GTCCTAACTCAAACGACGAGTTTTGCGGTGGATTTAATGCTGTTGAGATTTTTAGAACAG, WBGene00122135
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region