WormMine: Gene WBGene00122211

• WormBase Gene ID: WBGene00122211
• Gene Name: CJA03007
• Sequence Name: CJA03007
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable RNA polymerase I core promoter sequence-specific DNA binding activity. Predicted to be involved in RNA polymerase I preinitiation complex assembly. Predicted to be part of RNA polymerase I core factor complex. Is an ortholog of C. elegans F23H11.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA03007.1	CJA03007.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA03007	CJA03007		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1079433
• Remark: CJA03007, AAAATGAGGCTCAAGGACTACATGGCCAGTTTTGGACGAAAAGAGTACTGGGCAGTCGAG, WBGene00122211
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region