WormMine: Gene WBGene00122225

• WormBase Gene ID: WBGene00122225
• Gene Name: Cjp-dkf-1
• Sequence Name: CJA03021
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ATP binding activity; chondroitin 4-sulfotransferase activity; and protein serine/threonine kinase activity. Predicted to be involved in chondroitin sulfate biosynthetic process and positive regulation of response to oxidative stress. Predicted to be located in membrane. Is an ortholog of C. elegans dkf-1. In C. elegans, dkf-1 is involved in several processes, including defense response to Gram-positive bacterium; determination of adult lifespan; and positive regulation of protein import into nucleus.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA03021a.1	CJA03021a.1		[unknown]
Transcript:CJA03021b.1	CJA03021b.1		[unknown]
Transcript:CJA03021c.1	CJA03021c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA03021a	CJA03021a		[unknown]
CDS:CJA03021b	CJA03021b		[unknown]
CDS:CJA03021c	CJA03021c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

• Primary Identifier: Expr1084558
• Remark: CJA17410, TGGAGTTGTTGGTCAAAATGTTTTATCATGATTTTGTGTTGTTTAATTTTACTCTACCGG, WBGene00136614
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1076001
• Remark: Cjp-dkf-1, AAGCACGCATGTCCATCGAGCAGTGCCTGGAGCACGAGTGGCTAAAAGGCGAGCAACTGT, WBGene00122225
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

9 GO Annotation

0 Homologues

0 Locations

9 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region