WormMine: Gene WBGene00122252

• WormBase Gene ID: WBGene00122252
• Gene Name: Cjp-apr-1
• Sequence Name: CJA03048
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable beta-catenin binding activity. Predicted to be involved in negative regulation of Wnt signaling pathway. Is an ortholog of C. elegans apr-1. In C. elegans, apr-1 is involved in several processes, including embryonic morphogenesis; regulation of Wnt signaling pathway; and regulation of multicellular organismal development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA03048a.1	CJA03048a.1		[unknown]
Transcript:CJA03048b.1	CJA03048b.1		[unknown]
Transcript:CJA03048c.1	CJA03048c.1		[unknown]
Transcript:CJA03048d.1	CJA03048d.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA03048c	CJA03048c		[unknown]
CDS:CJA03048d	CJA03048d		[unknown]
CDS:CJA03048a	CJA03048a		[unknown]
CDS:CJA03048b	CJA03048b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081318
• Remark: Cjp-apr-1, TCAAACAAGAGACGACACTATTTACGTGAACGCACCGATAGTGGAGGCAGAGCAAGAGCG, WBGene00122252
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region