WormMine: Gene WBGene00122315

• WormBase Gene ID: WBGene00122315
• Gene Name: Cjp-pbo-4
• Sequence Name: CJA03111
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable sodium:proton antiporter activity. Predicted to be involved in proton transmembrane transport; regulation of pH; and sodium ion transport. Predicted to be located in membrane. Is an ortholog of C. elegans pbo-4. In C. elegans, pbo-4 is involved in several processes, including defecation; lipid transport involved in lipid storage; and positive regulation of multicellular organismal process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA03111.1	CJA03111.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA03111	CJA03111		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1085923
• Remark: Cjp-pbo-4, AGTTCATTCAAACGACAACAGACTTTTGATGAGATGGCAGAAAGTGGGGTCATTCCGCAC, WBGene00122315
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

8 GO Annotation

0 Homologues

0 Locations

8 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region