WormMine: Gene WBGene00122590

• WormBase Gene ID: WBGene00122590
• Gene Name: Cjp-gcy-7
• Sequence Name: CJA03386
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable guanylate cyclase activity and protein kinase activity. Predicted to be involved in cGMP biosynthetic process and intracellular signal transduction. Is an ortholog of C. elegans gcy-7. In C. elegans, gcy-7 is involved in chemosensory behavior; chemotaxis; and response to magnesium ion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA03386b.1	CJA03386b.1		[unknown]
Transcript:CJA03386a.1	CJA03386a.1		[unknown]
Transcript:CJA03386c.1	CJA03386c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA03386c	CJA03386c		[unknown]
CDS:CJA03386b	CJA03386b		[unknown]
CDS:CJA03386a	CJA03386a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1079249
• Remark: Cjp-gcy-7, TCAAGTCTTGAATCTTTCCGAATCCCCCACCTGCCCCACGAGCGCATCAATCTGAGAATC, WBGene00122590
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region