WormMine: Gene WBGene00122627

• WormBase Gene ID: WBGene00122627
• Gene Name: CJA03423
• Sequence Name: CJA03423
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable small GTPase binding activity and tRNA binding activity. Predicted to be involved in tRNA re-export from nucleus. Is an ortholog of C. elegans xpo-3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA03423a.1	CJA03423a.1		[unknown]
Transcript:CJA03423b.1	CJA03423b.1		[unknown]
Transcript:CJA03423c.1	CJA03423c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA03423a	CJA03423a		[unknown]
CDS:CJA03423b	CJA03423b		[unknown]
CDS:CJA03423c	CJA03423c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1079425
• Remark: CJA03423, ACGTCAGCAGTTTGTGCTCTTCTCGAGAAAGGAATGTCAGCGGAAAAGAAAGTGGGATTG, WBGene00122627
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region