WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00122660 Gene Name  CJA03456
Sequence Name  ? CJA03456 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Dual specificity protein phosphatase domain; Protein-tyrosine phosphatase-like; and Dual specificity phosphatase, catalytic domain. Is an ortholog of C. elegans F28C6.9. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA03456a.1 CJA03456a.1   [unknown]
Transcript:CJA03456b.1 CJA03456b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA03456a CJA03456a   [unknown]
CDS:CJA03456b CJA03456b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA03456, CAAGGTTGGAAAGTTCATCGGTGATCTTTTCGAAGAAGAGAAACCTGTCGAGCCAACTGC, WBGene00122660   Expr1073669 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA12344, GATTTGCAAATGGCGGAACGGCATCGGTTGGCGATGATTGATTGCAGGGATACGGTATTT, WBGene00131548   Expr1074001 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA05909, AAATGCTCACTGGAGAACTGTAAATGAGTATCGCCGGTTTTTGGATCAAAACTCTGTCTC, WBGene00125113   Expr1076256 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  involved_in
  involved_in

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  involved_in
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region