WormMine: Gene WBGene00122755

• WormBase Gene ID: WBGene00122755
• Gene Name: Cjp-slo-1
• Sequence Name: CJA03551
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable monoatomic ion channel activity. Predicted to be involved in potassium ion transport and transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans slo-1. In C. elegans, slo-1 is involved in several processes, including behavioral response to ethanol; nematode pharyngeal pumping; and sarcomere organization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA03551.1	CJA03551.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA03551	CJA03551		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1085143
• Remark: Cjp-slo-1, CCCTGGTCCTAATATAGTAATACAGCCGCAAACACAAGGATTTTTTATTGCGCAGAGCGC, WBGene00122755
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region