WormMine: Gene WBGene00122838

• WormBase Gene ID: WBGene00122838
• Gene Name: Cjp-twk-10
• Sequence Name: CJA03634
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable potassium channel activity. Predicted to be involved in potassium ion transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans twk-10.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA03634.1	CJA03634.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA03634	CJA03634		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1090345
• Remark: Cjp-twk-10, GCTCATGATGTCAGACGTGGGCAAGTTCTTTGCAGATGGGTTCGTCAAGATTTTCAATGA, WBGene00122838
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region