WormMine: Gene WBGene00122902

• WormBase Gene ID: WBGene00122902
• Gene Name: CJA03698
• Sequence Name: CJA03698
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable fatty acid amide hydrolase activity. Predicted to be involved in fatty acid metabolic process. Predicted to be located in lysosome. Is an ortholog of C. elegans asah-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA03698a.1	CJA03698a.1		[unknown]
Transcript:CJA03698c.1	CJA03698c.1		[unknown]
Transcript:CJA03698b.1	CJA03698b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA03698a	CJA03698a		[unknown]
CDS:CJA03698c	CJA03698c		[unknown]
CDS:CJA03698b	CJA03698b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070487
• Remark: Cjp-asah-1, GGGTTCGCGATGGAAAGCTGGTGTTCAAATCGAACAATTTCGCTGGATACATTGGAATTT, WBGene00122902
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region