WormMine: Gene WBGene00122920

• WormBase Gene ID: WBGene00122920
• Gene Name: CJA03716
• Sequence Name: CJA03716
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be involved in mitochondrial electron transport, ubiquinol to cytochrome c. Predicted to be part of mitochondrial respiratory chain complex III. Is an ortholog of C. elegans F45H10.2 and R07E4.3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA03716b.1	CJA03716b.1		[unknown]
Transcript:CJA03716a.1	CJA03716a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA03716b	CJA03716b		[unknown]
CDS:CJA03716a	CJA03716a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1076134
• Remark: CJA03716, ATCAAGACGAACCATGCCGCTGGTCGCAAGAATCCTGCTGATTTTGCCAATGACCAGTAA, WBGene00122920
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region