WormMine: Gene WBGene00122956

• WormBase Gene ID: WBGene00122956
• Gene Name: Cjp-npp-3
• Sequence Name: CJA03752
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be part of nuclear pore. Is an ortholog of C. elegans npp-3. In C. elegans, npp-3 is involved in several processes, including establishment of localization in cell; positive regulation of nematode male tail tip morphogenesis; and regulation of cell cycle.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA03752a.1	CJA03752a.1		[unknown]
Transcript:CJA03752c.1	CJA03752c.1		[unknown]
Transcript:CJA03752b.1	CJA03752b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA03752b	CJA03752b		[unknown]
CDS:CJA03752a	CJA03752a		[unknown]
CDS:CJA03752c	CJA03752c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1092040
• Remark: CJA03752, GCAACTACGAGTCGGCGCTTTCAAATTATGAGAATTTCCTGAGAAGCTTTGTGGATTTGT, WBGene00122956
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region