WormMine: Gene WBGene00123129

• WormBase Gene ID: WBGene00123129
• Gene Name: Cjp-mrpl-23
• Sequence Name: CJA03925
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be a structural constituent of ribosome. Predicted to be involved in translation. Predicted to be located in ribosome. Is an ortholog of C. elegans mrpl-23.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA03925a.1	CJA03925a.1		[unknown]
Transcript:CJA03925a.2	CJA03925a.2		[unknown]
Transcript:CJA03925b.1	CJA03925b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA03925a	CJA03925a		[unknown]
CDS:CJA03925b	CJA03925b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1080544
• Remark: CJA03925, TAAGCTCAACGAGCGATTTGCCAATAGAAATCGCCGAGTTGGAAACTTTTTGGGATCTTA, WBGene00123129
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region