WormMine: Gene WBGene00123195

• WormBase Gene ID: WBGene00123195
• Gene Name: Cjp-hil-1
• Sequence Name: CJA03991
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable DNA binding activity. Predicted to be a structural constituent of chromatin. Predicted to be involved in nucleosome assembly. Predicted to be part of nucleosome. Is an ortholog of C. elegans hil-1. In C. elegans, hil-1 is involved in several processes, including body morphogenesis; egg-laying behavior; and pharynx development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA03991b.1	CJA03991b.1		[unknown]
Transcript:CJA03991a.1	CJA03991a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA03991b	CJA03991b		[unknown]
CDS:CJA03991a	CJA03991a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1075301
• Remark: Cjp-hil-1, GTTAAGCCAGAAGCTCCACCCACTACCACGATGGAGCTTCGCACCGGAACCAGAAAGAGT, WBGene00123195
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region