WormMine: Gene WBGene00123417

• WormBase Gene ID: WBGene00123417
• Gene Name: Cjp-rev-3.1
• Sequence Name: CJA04213
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be involved in translesion synthesis. Predicted to be part of zeta DNA polymerase complex. Is an ortholog of C. elegans rev-3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA04213a.1	CJA04213a.1		[unknown]
Transcript:CJA04213b.1	CJA04213b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA04213b	CJA04213b		[unknown]
CDS:CJA04213a	CJA04213a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1090441
• Remark: CJA04213, CACATCCCATTTCACTTGCAGTTTTTCATCGATAACTCGATTTTCGGAATGGATAATATC, WBGene00123417
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region