WormMine: Gene WBGene00123438

• WormBase Gene ID: WBGene00123438
• Gene Name: Cjp-tph-1
• Sequence Name: CJA04234
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable iron ion binding activity and oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced pteridine as one donor, and incorporation of one atom of oxygen. Predicted to be involved in aromatic amino acid metabolic process. Is an ortholog of C. elegans tph-1. In C. elegans, tph-1 is involved in several processes, including determination of adult lifespan; locomotory exploration behavior; and positive regulation of transforming growth factor beta receptor signaling pathway.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA04234.1	CJA04234.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA04234	CJA04234		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1086797
• Remark: Cjp-tph-1, GTTACAATCCGTACACTGAGAGTGTCGAAGTGCTCAACAATCCAAGATCCATTATGTTGG, WBGene00123438
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region