WormMine: Gene WBGene00123673

• WormBase Gene ID: WBGene00123673
• Gene Name: Cjp-ulp-1
• Sequence Name: CJA04469
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable cysteine-type peptidase activity. Predicted to be involved in proteolysis. Is an ortholog of C. elegans ulp-1. In C. elegans, ulp-1 is involved in several processes, including embryo development; positive regulation of error-prone translesion synthesis; and protein desumoylation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA04469a.1	CJA04469a.1		[unknown]
Transcript:CJA04469a.2	CJA04469a.2		[unknown]
Transcript:CJA04469b.1	CJA04469b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA04469a	CJA04469a		[unknown]
CDS:CJA04469b	CJA04469b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1085658
• Remark: Cjp-ulp-1, CCTATTCATCTGGGAATGCATTGGTGCATGTCTGTAATTGATATCGATGAGAAGAAAATC, WBGene00123673
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region