WormMine: Gene WBGene00123803

• WormBase Gene ID: WBGene00123803
• Gene Name: Cjp-crls-1
• Sequence Name: CJA04599
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable phosphotransferase activity, for other substituted phosphate groups. Predicted to be involved in phospholipid biosynthetic process. Predicted to be located in membrane. Is an ortholog of C. elegans crls-1. In C. elegans, crls-1 is involved in cardiolipin biosynthetic process; regulation of cell population proliferation; and regulation of mitochondrial membrane potential.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA04599a.1	CJA04599a.1		[unknown]
Transcript:CJA04599b.1	CJA04599b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA04599a	CJA04599a		[unknown]
CDS:CJA04599b	CJA04599b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1091476
• Remark: CJA04599, CAATCCACAGGTCAACTCGATGCAAGTCGTTCCCACTATGATGAGCAAGGTGAGTGAAAA, WBGene00123803
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region