WormMine: Gene WBGene00123962

• WormBase Gene ID: WBGene00123962
• Gene Name: CJA04758
• Sequence Name: CJA04758
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable 1,4-alpha-glucan branching enzyme activity. Predicted to be involved in glycogen biosynthetic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA04758.1	CJA04758.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA04758	CJA04758		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1087605
• Remark: CJA04758, AAAAAGTACCCCGAAATGATCACAATTGCCGAAGAAGTGTCTGGAATGCCGGCCGTTTGC, WBGene00123962
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region