WormMine: Gene WBGene00124307

• WormBase Gene ID: WBGene00124307
• Gene Name: Cjp-ser-1
• Sequence Name: CJA05103
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable G protein-coupled receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Predicted to be located in membrane. Is an ortholog of C. elegans ser-1. In C. elegans, ser-1 is involved in several processes, including reproductive behavior; response to heat; and signal transduction.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA05103a.1	CJA05103a.1		[unknown]
Transcript:CJA05103c.1	CJA05103c.1		[unknown]
Transcript:CJA05103b.1	CJA05103b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA05103c	CJA05103c		[unknown]
CDS:CJA05103a	CJA05103a		[unknown]
CDS:CJA05103b	CJA05103b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1074187
• Remark: Cjp-ser-1, TTCAGCTGGTGCTGCAAATGGAACTGCAAATGGTTCTGCCAAACGTCATTTGACACTTTT, WBGene00124307
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region