WormMine: Gene WBGene00125049

• WormBase Gene ID: WBGene00125049
• Gene Name: Cjp-gcy-12
• Sequence Name: CJA05845
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable protein kinase activity. Predicted to be involved in cyclic nucleotide biosynthetic process and intracellular signal transduction. Is an ortholog of C. elegans gcy-12. In C. elegans, gcy-12 is involved in negative regulation of dauer larval development; regulation of growth; and regulation of locomotion involved in locomotory behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA05845a.2	CJA05845a.2		[unknown]
Transcript:CJA05845a.1	CJA05845a.1		[unknown]
Transcript:CJA05845b.1	CJA05845b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA05845b	CJA05845b		[unknown]
CDS:CJA05845a	CJA05845a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1089707
• Remark: Cjp-gcy-12, CACTTATTGGTTGAACGGTCGTGCCGGATACGAGTTCACCGAAACTATCGAAGACAAAAT, WBGene00125049
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region