WormMine: Gene WBGene00125059

• WormBase Gene ID: WBGene00125059
• Gene Name: CJA05855
• Sequence Name: CJA05855
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be located in peroxisome. Is an ortholog of C. elegans F54B3.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA05855a.1	CJA05855a.1		[unknown]
Transcript:CJA05855b.1	CJA05855b.1		[unknown]
Transcript:CJA05855c.1	CJA05855c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA05855c	CJA05855c		[unknown]
CDS:CJA05855a	CJA05855a		[unknown]
CDS:CJA05855b	CJA05855b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1079751
• Remark: CJA05855, GTGAACTCTGGCCACCCACAGAAGATCGAACGTTTATTGCGCAATTCGAGGGAAAACAGC, WBGene00125059
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region