WormMine: Gene WBGene00125199

• WormBase Gene ID: WBGene00125199
• Gene Name: Cjp-mcp-1
• Sequence Name: CJA05995
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable GDP-D-glucose phosphorylase activity. Is an ortholog of C. elegans mcp-1. In C. elegans, mcp-1 is involved in glucose metabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA05995.1	CJA05995.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA05995	CJA05995		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1086297
• Remark: CJA05995, CAACGAACAAGCGGTAATTCGAATAATTGAGGAGGAGGCGTCACTAGATGACGACACGTT, WBGene00125199
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region