WormMine: Gene WBGene00125205

• WormBase Gene ID: WBGene00125205
• Gene Name: Cjp-cyp-37B1
• Sequence Name: CJA06001
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable heme binding activity; iron ion binding activity; and oxidoreductase activity. Is an ortholog of C. elegans cyp-37B1. In C. elegans, cyp-37B1 is involved in defense response to Gram-positive bacterium.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA06001.1	CJA06001.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA06001	CJA06001		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081200
• Remark: Cjp-cyp-37B1, GTCCACTCACCGAAAATTCCACGATAATCAAATGCTGCCCGAGATTATTCTCAAGTCCAC, WBGene00125205
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region