WormMine: Gene WBGene00125364

• WormBase Gene ID: WBGene00125364
• Gene Name: Cjp-ddo-2
• Sequence Name: CJA06160
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable D-amino-acid oxidase activity and FAD binding activity. Predicted to be involved in D-amino acid metabolic process. Is an ortholog of C. elegans ddo-2. In C. elegans, ddo-2 is involved in aspartate catabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA06160.1	CJA06160.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA06160	CJA06160		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1082142
• Remark: Cja-ddo-2, GGAAGTAACGGATTCACACTTGGCTGGGGAACAGCGCTAGAGGTTACCAAATTGGTGAAA, WBGene00125364
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region