WormMine: Gene WBGene00125458

• WormBase Gene ID: WBGene00125458
• Gene Name: Cjp-vps-28
• Sequence Name: CJA06254
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be involved in endosome transport via multivesicular body sorting pathway. Predicted to be part of ESCRT I complex. Is an ortholog of C. elegans vps-28. In C. elegans, vps-28 is involved in receptor catabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA06254.1	CJA06254.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA06254	CJA06254		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1077252
• Remark: Cjp-vps-28, GACAAATGACTTTTGACGTCGAGTCGGCGTATCACGCGTTCAACAAGGCGCTTCACGAGC, WBGene00125458
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region