WormMine: Gene WBGene00125500

• WormBase Gene ID: WBGene00125500
• Gene Name: Cjp-sig-7
• Sequence Name: CJA06296
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable RNA binding activity and peptidyl-prolyl cis-trans isomerase activity. Is an ortholog of C. elegans sig-7. In C. elegans, sig-7 is involved in nematode larval development; positive regulation of developmental process; and transcription elongation-coupled chromatin remodeling.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA06296.1	CJA06296.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA06296	CJA06296		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1090106
• Remark: Cjp-sig-7, GAAGAGTTGCGAGAATGCGTTCTTCAAAATGGACAATGTGCTCATCGATGATCGACGCAT, WBGene00125500
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region