WormMine: Gene WBGene00125669

• WormBase Gene ID: WBGene00125669
• Gene Name: Cjp-let-765
• Sequence Name: CJA06465
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans let-765. In C. elegans, let-765 is involved in several processes, including nematode male tail tip morphogenesis; positive regulation of Ras protein signal transduction; and vulval cell fate specification.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA06465.1	CJA06465.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA06465	CJA06465		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070755
• Remark: Cjp-nsh-1, GGAAACAACAGTTTGACTGCGCGGCGACCATGTGTCAGCACAATTATGTGTACTCGAAGT, WBGene00125669
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region