WormMine: Gene WBGene00126411

• WormBase Gene ID: WBGene00126411
• Gene Name: Cjp-acr-9
• Sequence Name: CJA07207
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable acetylcholine-gated monoatomic cation-selective channel activity and transmembrane signaling receptor activity. Predicted to be involved in monoatomic ion transmembrane transport. Predicted to be located in postsynaptic membrane. Is an ortholog of C. elegans acr-9.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA07207a.1	CJA07207a.1		[unknown]
Transcript:CJA07207b.1	CJA07207b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA07207b	CJA07207b		[unknown]
CDS:CJA07207a	CJA07207a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1079032
• Remark: Cjp-acr-9, CTTAATCTTATCATACCATCGTTCCTCATATCACTTATGACTGTTCTTGGATTCACACTT, WBGene00126411
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

8 GO Annotation

0 Homologues

0 Locations

8 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region