WormMine: Gene WBGene00126568

• WormBase Gene ID: WBGene00126568
• Gene Name: Cjp-cwn-2
• Sequence Name: CJA07364
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable signaling receptor binding activity. Predicted to be involved in Wnt signaling pathway. Predicted to be located in extracellular region. Is an ortholog of C. elegans cwn-2. In C. elegans, cwn-2 is involved in several processes, including neuroblast migration; neuron migration; and pattern specification process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA07364.1	CJA07364.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA07364	CJA07364		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1082938
• Remark: Cjp-cwn-2, TTTGCTGCGGGCGGGGCTACAACACGTACACCCAAGAGGTCAAATCAAAGTGTAATTGCA, WBGene00126568
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region