WormMine: Gene WBGene00126579

• WormBase Gene ID: WBGene00126579
• Gene Name: Cjp-atat-2
• Sequence Name: CJA07375
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable tubulin N-acetyltransferase activity. Predicted to be located in microtubule. Is an ortholog of C. elegans atat-2. In C. elegans, atat-2 is involved in thigmotaxis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA07375.1	CJA07375.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA07375	CJA07375		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1071506
• Remark: CJA07375, AAGTTGACCCGAATAGTCCGACAGGATTGAAGAACTCTCGGGATTTTGGGCATCGGAGAA, WBGene00126579
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region