WormMine: Gene WBGene00126704

• WormBase Gene ID: WBGene00126704
• Gene Name: Cjp-cyp-32B1.3
• Sequence Name: CJA07500
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable heme binding activity; iron ion binding activity; and oxidoreductase activity. Is an ortholog of C. elegans cyp-32B1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA07500b.1	CJA07500b.1		[unknown]
Transcript:CJA07500a.1	CJA07500a.1		[unknown]
Transcript:CJA07500d.1	CJA07500d.1		[unknown]
Transcript:CJA07500c.1	CJA07500c.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA07500a	CJA07500a		[unknown]
CDS:CJA07500b	CJA07500b		[unknown]
CDS:CJA07500c	CJA07500c		[unknown]
CDS:CJA07500d	CJA07500d		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1091314
• Remark: CJA07500, ACAAGATATCCTGATGATATTCCGATTACAGAGCTCATATTGAAGCCAGTCAATGGGACA, WBGene00126704
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region