WormMine: Gene WBGene00126790

• WormBase Gene ID: WBGene00126790
• Gene Name: Cjp-cox-7C
• Sequence Name: CJA07586
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be involved in mitochondrial electron transport, cytochrome c to oxygen. Predicted to be part of mitochondrial respiratory chain complex IV. Is an ortholog of C. elegans cox-7C.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA07586.1	CJA07586.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA07586	CJA07586		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1072939
• Remark: CJA07586, ATCGGCTTCTGGGCTCCGTTCATCGTCGTCGAGTACCAGCTGAGAAAGGCCAACCAATAA, WBGene00126790
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region