WormMine: Gene WBGene00126794

• WormBase Gene ID: WBGene00126794
• Gene Name: Cjp-scp-1
• Sequence Name: CJA07590
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable sterol binding activity. Predicted to be involved in SREBP signaling pathway. Predicted to be located in Golgi membrane and endoplasmic reticulum membrane. Is an ortholog of C. elegans scp-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA07590a.1	CJA07590a.1		[unknown]
Transcript:CJA07590c.1	CJA07590c.1		[unknown]
Transcript:CJA07590b.1	CJA07590b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA07590c	CJA07590c		[unknown]
CDS:CJA07590b	CJA07590b		[unknown]
CDS:CJA07590a	CJA07590a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1080678
• Remark: Cjp-scp-1, AAGTCATGTATTTCATCACACGGACACGAATTGCTCAACGAACTATTCTAGTGGTTTTTG, WBGene00126794
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region