WormMine: Gene WBGene00127186

• WormBase Gene ID: WBGene00127186
• Gene Name: Cjp-acn-1
• Sequence Name: CJA07982
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable metallopeptidase activity and peptidyl-dipeptidase activity. Predicted to be involved in proteolysis. Predicted to be located in membrane. Is an ortholog of C. elegans acn-1. In C. elegans, acn-1 is involved in ecdysis, collagen and cuticulin-based cuticle and nematode male tail tip morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA07982.1	CJA07982.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA07982	CJA07982		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1085415
• Remark: Cjp-acn-1, AATGAGGGACTTTTCACTTTGGAAATCGGAAACACTGTTAACTGTGTTCCAGGAAATCCA, WBGene00127186
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region