WormMine: Gene WBGene00127351

• WormBase Gene ID: WBGene00127351
• Gene Name: Cjp-tomm-40
• Sequence Name: CJA08147
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable protein transmembrane transporter activity. Predicted to be involved in protein import into mitochondrial matrix. Predicted to be located in mitochondrial outer membrane. Is an ortholog of C. elegans tomm-40. In C. elegans, tomm-40 is involved in protein import into mitochondrial matrix.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA08147.1	CJA08147.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA08147	CJA08147		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1077719
• Remark: Cja-tomm-40, AATGCAAATGTTGGAGAGGCTGTAACTACACTTGCTTATCAGACTGAGCTTCCAGAGGAA, WBGene00127351
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region