WormMine: Gene WBGene00127354

• WormBase Gene ID: WBGene00127354
• Gene Name: Cjp-vps-45
• Sequence Name: CJA08150
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be involved in vesicle-mediated transport. Is an ortholog of C. elegans vps-45. In C. elegans, vps-45 is involved in pinocytosis and receptor-mediated endocytosis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA08150.1	CJA08150.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA08150	CJA08150		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1087820
• Remark: Cjp-vps-45, ATCAATGGACTTATGAAGCTATGATTCATGAACTCCTTGGCACATCAAACAACCGGTTGA, WBGene00127354
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region